Top » Catalog » SNPs » S562

$18.00

S562
[S562]

S562
hg38 Position: ChrY:7213592..7213592
Ancestral: C
Derived: T
Reference: Jim Wilson (2014)
ISOGG Haplogroup: not listed
Comments: .
Forward Primer: S562_F ATGTTAGCCACAATGGTCTCG
Reverse Primer: S562_R CATTAGTGTGGTACACGTGTTACAAC
Reviews

Customers who bought this product also purchased
S564
S564
FGC452
FGC452
S556
S556
S567
S567
S563
S563
FGC450
FGC450
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies