Top » Catalog » SNPs » S563

$18.00

S563
[S563]

S563
hg38 Position: ChrY:26409953..26409953
Ancestral: G
Derived: C
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a2a1a2c1a1a1 (not listed)
Comments: .
Forward Primer: S563_F GCTGGAGTGGTAGACTTCACC
Reverse Primer: S563_R AGGCACCTCCTAGCCCCT
Reviews

Customers who bought this product also purchased
S558
S558
S565
S565
FGC454
FGC454
S557
S557
S564
S564
FGC452
FGC452
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies