Top » Catalog » SNPs » YFS523972

$18.00

YFS523972
[YFS523972]

YFS523972
hg38 Position: ChrY:15098954..15098954
Ancestral: G
Derived: C
Reference: YFull (2016)
ISOGG Haplogroup: E
Comments: .
Forward Primer: YFS523972_F CTTTTTCGAAGTGGCTTCATC
Reverse Primer: YFS523972_R TGGGTCTCAGATGCTTCCTG
Reviews

Customers who bought this product also purchased
YFS523985
YFS523985
A10164
A10164
A6111
A6111
E1a1-Z31503 Phelps Panel
E1a1-Z31503 Phelps Panel
A10163
A10163
A6110
A6110
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies