Top » Catalog » SNPs » A10629

$18.00

A10629
[A10629]

A10629
hg38 Position: ChrY:21849925..21849925
Ancestral: G
Derived: A
Reference: Jim Graham (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream M222 > DF104 > FGC4108/S588
Forward Primer: A10629_F CTTTTCAGCTGGAGAAATAATTATTG
Reverse Primer: A10629_R CCTTCTCCACTTGCTCTGG
Reviews

Customers who bought this product also purchased
A5386
A5386
Y81784
Y81784
S588
S588
FGC10135
FGC10135
A17594
A17594
S659
S659
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies