Top » Catalog » SNPs » A9884

$19.00

A9884
[A9884]

A9884
hg38 Position: ChrY:12129147..12129147
Ancestral: A
Derived: C
Reference: Alex Williamson (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below M222 > S588
Forward Primer: A9884_F ATCAGGCTGGTTGGGACAC
Reverse Primer: A9884_R ACTCTTATTATTTTGAGATAGATTGCATTG
Reviews

Customers who bought this product also purchased
S588
S588
FGC4113
FGC4113
R1b-DF49 (including M222) North West Irish Panel
R1b-DF49 (including M222) North West Irish Panel
A8591
A8591
S590
S590
FGC23592
FGC23592
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies