Top » Catalog » SNPs » A9886

$18.00

A9886
[A9886]

A9886
hg38 Position: ChrY:18937215..18937215
Ancestral: G
Derived: T
Reference: Alex Williamson (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below M222 > S588
Forward Primer: A9886_F AGAAACTTGCCCACCATGTC
Reverse Primer: A9886_R TGTGCAGGTAGGGACATAGAC
Reviews

Customers who bought this product also purchased
Y9391
Y9391
A694
A694
A17594
A17594
F1265
F1265
S603
S603
FGC23592
FGC23592
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies