Top » Catalog » SNPs » S555

$18.00

S555
[S555]

S555
hg38 Position: ChrY:7360170..7360170
Ancestral: T
Derived: C
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a2a1a2c1a1a1 (not listed)
Comments: .
Forward Primer: S555v2_F GCCTAGATGCTAACACCGCA
Reverse Primer: S555v2_R TTAGCTGGGCATGCTGATG
Reviews

Customers who bought this product also purchased
FGC12950
FGC12950
A359
A359
Z2980
Z2980
S588
S588
DF49
DF49
M222
M222
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies