Top » Catalog » SNPs » S567

$18.00

S567
[S567]

S567
hg38 Position: ChrY:19336659..19336659
Ancestral: G
Derived: C
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a2a1a2c1a1a1 (not listed)
Comments: .
Forward Primer: S567_F TCAGGAGGAACGGTACCG
Reverse Primer: S567_R GCTTACAGTTTTTGCCCATTG
Reviews

Customers who bought this product also purchased
S568
S568
S566
S566
FGC455
FGC455
S559
S559
S565
S565
FGC454
FGC454
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies