Top » Catalog » SNPs » F3393

$18.00

F3393
[F3393]

F3393
hg38 Position: ChrY:20862088..20862088
Ancestral: C
Derived: A
Reference: Yan Shi (2011)
ISOGG Haplogroup: C1
Comments: Found in a hg C person. Likely a singleton.
Forward Primer: F3393_F TTCTCAGACCCCAGGTGAAG
Reverse Primer: F3393_R CTACTGCCAGTGGTGACAGG
Reviews

Customers who bought this product also purchased
M217
M217
V184
V184
C Superclade Panel
C Superclade Panel
A701
A701
Z28000
Z28000
M216
M216
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies