Top » Catalog » SNPs » M216

$18.00

M216
[M216]

M216
hg38 Position: ChrY:13325684..13325684
Ancestral: C
Derived: T
Reference: Underhill et al. 2001
ISOGG Haplogroup: C
Comments: UTY1intron18
Forward Primer: M216_F GGCCAGTATCTCCAAAATCC
Reverse Primer: M216_R GAGACTAGGTTGCCCATAAAGC
Reviews

Customers who bought this product also purchased
M96
M96
M173
M173
Y-GATA-H4
Y-GATA-H4
YSEQ-Alpha-Beta
YSEQ-Alpha-Beta
P38
P38
YSEQ-Alpha
YSEQ-Alpha
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies