Top » Catalog » SNPs » M216

$18.00

M216
[M216]

M216
hg38 Position: ChrY:13325684..13325684
Ancestral: C
Derived: T
Reference: Underhill et al. 2001
ISOGG Haplogroup: C
Comments: UTY1intron18
Forward Primer: M216_F GGCCAGTATCTCCAAAATCC
Reverse Primer: M216_R GAGACTAGGTTGCCCATAAAGC
Reviews

Customers who bought this product also purchased
Z638
Z638
S23613
S23613
Y86930
Y86930
Z2432
Z2432
Z2507
Z2507
PH1602
PH1602
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies