Top » Catalog » SNPs » M216

$18.00

M216
[M216]

M216
hg38 Position: ChrY:13325684..13325684
Ancestral: C
Derived: T
Reference: Underhill et al. 2001
ISOGG Haplogroup: C
Comments: UTY1intron18
Forward Primer: M216_F GGCCAGTATCTCCAAAATCC
Reverse Primer: M216_R GAGACTAGGTTGCCCATAAAGC
Reviews

Customers who bought this product also purchased
Z42941
Z42941
Z40052
Z40052
M12
M12
Z575
Z575
Z34473
Z34473
PH1568
PH1568
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies