Top » Catalog » SNPs » M216

$18.00

M216
[M216]

M216
HG19 Position: ChrY:13325684..13325684
Ancestral: C
Derived: T
Reference: Underhill et al. 2001
ISOGG Haplogroup: C
Comments: UTY1intron18
Forward Primer: M216_F GGCCAGTATCTCCAAAATCC
Reverse Primer: M216_R GAGACTAGGTTGCCCATAAAGC
Reviews

Customers who bought this product also purchased
L145
L145
M438
M438
M242
M242
M253
M253
M175
M175
M201
M201
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies