Top » Catalog » SNPs » M216

$18.00

M216
[M216]

M216
hg38 Position: ChrY:13325684..13325684
Ancestral: C
Derived: T
Reference: Underhill et al. 2001
ISOGG Haplogroup: C
Comments: UTY1intron18
Forward Primer: M216_F GGCCAGTATCTCCAAAATCC
Reverse Primer: M216_R GAGACTAGGTTGCCCATAAAGC
Reviews

Customers who bought this product also purchased
F3393
F3393
CTS4590
CTS4590
K511
K511
CTS2457.1
CTS2457.1
F929
F929
FGC39579
FGC39579
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies