Top » Catalog » SNPs » F3918

$18.00

F3918
[F3918]

F3918
hg38 Position: ChrY:12422081..12422081
Ancestral: A
Derived: T
Reference: Yan Shi (2011)
ISOGG Haplogroup: C2b1a
Comments: Found in a hg C person. Close to .
Forward Primer: F3918_F CCCCAGCTACCAAGGAGAG
Reverse Primer: F3918_R AGTCACTCCTCCATTCATGC
Reviews

Customers who bought this product also purchased
Y12782
Y12782
SK1076
SK1076
Y4541
Y4541
FGC29011
FGC29011
Y4580
Y4580
FGC16217
FGC16217
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies