Top » Catalog » SNPs » A583

$18.00

A583
[A583]

A583
HG19 Position: ChrY:8270377..8270377
Ancestral: T
Derived: C
Reference:
ISOGG Haplogroup: R1b (not listed)
Comments: Approx. L188
Forward Primer: A583_F TGAAGTATATGCTATCAATCAAAGTGAAG
Reverse Primer: A583_R AACATTTTAGCTCTTCATTATGCTGTAC
Reviews

Customers who bought this product also purchased
DYS441
DYS441
DYS534
DYS534
DYS463
DYS463
YSEQ-Alpha-Beta
YSEQ-Alpha-Beta
DYS522
DYS522
DYS717
DYS717
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies