Top » Catalog » SNPs » A583

$18.00

A583
[A583]

A583
hg38 Position: ChrY:8402336..8402336
Ancestral: T
Derived: C
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Approx. L188
Forward Primer: A583_F TGAAGTATATGCTATCAATCAAAGTGAAG
Reverse Primer: A583_R AACATTTTAGCTCTTCATTATGCTGTAC
Reviews

Customers who bought this product also purchased
DYS717
DYS717
DYS504
DYS504
DYS444
DYS444
DYS532
DYS532
DYS520
DYS520
DYS441
DYS441
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies