Top » Catalog » SNPs » M86

$18.00

M86
[M86]

M86
hg38 Position: ChrY:19744031..19744031
Ancestral: T
Derived: G
Reference: Underhill et al. 2001
ISOGG Haplogroup: C2b1b1
Comments: B9.t25a
Forward Primer: M86_F GCAACCCAAAATGGTCTACG
Reverse Primer: M86_R CTTTTCTGACCCGAACAAGC
Reviews

Customers who bought this product also purchased
Z30402
Z30402
F3830
F3830
F1756
F1756
Z30589
Z30589
C Superclade Panel
C Superclade Panel
B81
B81
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies