Top » Catalog » SNPs » Y2902

$18.00

Y2902
[Y2902]

Y2902
hg38 Position: ChrY:19443884..19443884
Ancestral: G
Derived: T
Reference: Yfull (2014)
ISOGG Haplogroup: R-CTS3402
Comments: Downstream R1a-CTS3402
Forward Primer: Y2902_F AAATTTGGTGCATTGTTCAGG
Reverse Primer: Y2902_R TTACTGGCCTGCACAGTGG
Reviews (1)

Customers who bought this product also purchased
YP4336
YP4336
YP6012
YP6012
R1a-Z93 Panel
R1a-Z93 Panel
A15622
A15622
YP5225
YP5225
L657
L657
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies