Top » Catalog » SNPs » Z17774

$18.00

Z17774
[Z17774]

Z17774
hg38 Position: ChrY:8385830..8385830
Ancestral: G
Derived: A
Reference: Y DNA community
ISOGG Haplogroup: G2a1a2
Comments: Below L293
Forward Primer: Z17774v2_F ATTAGCCAGGCGTGGTAGTG
Reverse Primer: Z17774v2_R CCAGTACCTAGGTGGAATAATTCTCTC
Reviews

Customers who bought this product also purchased
G Superclade Panel
G Superclade Panel
FGC750
FGC750
FGC715
FGC715
Z31470
Z31470
G2a-Z6552 Panel
G2a-Z6552 Panel
Z31475
Z31475
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies