Top » Catalog » SNPs » Y17760

$18.00

Y17760
[Y17760]

Y17760
hg38 Position: ChrY:14170937..14170937
Ancestral: G
Derived: T
Reference: YFull (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF27 > FGC20764 > FGC20767
Forward Primer: Y17760_F CAGAGGTCTCCTGCATGGAC
Reverse Primer: Y17760_R GGAGACCATTCAGATATAACAATGAG
Reviews

Customers who bought this product also purchased
FGC20764
FGC20764
M168
M168
Y107967
Y107967
L21
L21
Z225
Z225
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies