Top » Catalog » SNPs » A10519

$18.00

A10519
[A10519]

A10519
hg38 Position: ChrY:17258087..17258087
Ancestral: C
Derived: T
Reference: James Royal (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below DF27
Forward Primer: A10519_F ATTTTGCTATGTTTCCCCAGC
Reverse Primer: A10519_R CATATTTTAATGTTCTATGTGCATGTTTG
Reviews

Customers who bought this product also purchased
A10518
A10518
A10523
A10523
A10522
A10522
A10521
A10521
A10520
A10520
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies