Top » Catalog » SNPs » A10680

$18.00

A10680
[A10680]

A10680
hg38 Position: ChrY:15168408..15168408
Ancestral: C
Derived: A
Reference: Geoff Melloy (2016)
ISOGG Haplogroup: R1b
Comments: Below DF49 > DF85 > S668
Forward Primer: A10680_F CAAGTAATTATCATTTACTCTTTGCCC
Reverse Primer: A10680_R GTTATGCCAAATTGTTAAACCACAG
Reviews

Customers who bought this product also purchased
A10682
A10682
A10679
A10679
A10678
A10678
A10677
A10677
A10681
A10681
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies