Top » Catalog » SNPs » Y7825

$18.00

Y7825
[Y7825]

Y7825
hg38 Position: ChrY:6997512..6997512
Ancestral: A
Derived: G
Reference: Yfull (2015)
ISOGG Haplogroup: I2a2a
Comments: .
Forward Primer: Y7825_F ATTTGCTAAAATAAATCGGAGAAGG
Reverse Primer: Y7825_R GGAGTACACTGGTAGAAATGAGAACAC
Reviews

Customers who bought this product also purchased
A11210
A11210
I2a-Y7829 Royce Panel
I2a-Y7829 Royce Panel
A11209
A11209
A11214
A11214
A11208
A11208
A11213
A11213
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies