Top » Catalog » SNPs » Y7825

$18.00

Y7825
[Y7825]

Y7825
hg38 Position: ChrY:6997512..6997512
Ancestral: A
Derived: G
Reference: Yfull (2015)
ISOGG Haplogroup: I2a2a
Comments: .
Forward Primer: Y7825_F ATTTGCTAAAATAAATCGGAGAAGG
Reverse Primer: Y7825_R GGAGTACACTGGTAGAAATGAGAACAC
Reviews

Customers who bought this product also purchased
A11213
A11213
A11207
A11207
A11212
A11212
Y7828
Y7828
A11211
A11211
Y7829
Y7829
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies