Top » Catalog » SNPs » A10738

$19.00

A10738
[A10738]

A10738
hg38 Position: ChrY:15299123..15299123
Ancestral: G
Derived: A
Reference: Alex Buchanan (2016)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A10738_F GCAGCAGCTCTGACATCTTG
Reverse Primer: A10738_R ATACGCACATTCTTTCATTTGG
Reviews

Customers who bought this product also purchased
S691
S691
A10652
A10652
S764
S764
A6091
A6091
S744
S744
FGC32580
FGC32580
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies