Top » Catalog » SNPs » FGC45253

$18.00

FGC45253
[FGC45253]

FGC45253
hg38 Position: ChrY:12844539..12844539
Ancestral: T
Derived: C
Reference: Full Genomes (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below U106 > Z18
Forward Primer: FGC45253_F TGAGCAGGAAGAACATTTTATCAG
Reverse Primer: FGC45253_R CCTTACTGGGAATCTCACACG
Reviews

Customers who bought this product also purchased
A10245
A10245
A10244
A10244
PF1237
PF1237
FGC45245
FGC45245
FGC45254
FGC45254
FGC45251
FGC45251
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies