Top » Catalog » SNPs » FGC45254

$18.00

FGC45254
[FGC45254]

FGC45254
hg38 Position: ChrY:19517136..19517136
Ancestral: A
Derived: G
Reference: Full Genomes (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below U106 > Z18
Forward Primer: FGC45254_F ATCAAAAAACCAAGAGTTGCAAC
Reverse Primer: FGC45254_R TGGTGAGTTCTGTGGATGTTG
Reviews

Customers who bought this product also purchased
YSEQ-Alpha-Beta
YSEQ-Alpha-Beta
FGC15270
FGC15270
FGC15271
FGC15271
FGC15269
FGC15269
A10244
A10244
PF1237
PF1237
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies