Top » Catalog » SNPs » L126

$18.00

L126
[L126]

L126
hg38 Position: ChrY:12789700..12789700
Ancestral: C
Derived: T
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: I2a2a1a1a1
Comments: derived in I-M284
Forward Primer: L126_F GGAGGGAGAGGTTGTAGTGAGTC
Reverse Primer: L126_R ACTACACACGTAGTAACACCCTGG
Reviews

Customers who bought this product also purchased
A11616
A11616
A5860
A5860
A2239
A2239
A2228
A2228
A11612
A11612
Y11858
Y11858
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies