Top » Catalog » SNPs » L126

$18.00

L126
[L126]

L126
hg38 Position: ChrY:12789700..12789700
Ancestral: C
Derived: T
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: I2a2a1a1a1
Comments: derived in I-M284
Forward Primer: L126_F GGAGGGAGAGGTTGTAGTGAGTC
Reverse Primer: L126_R ACTACACACGTAGTAACACCCTGG
Reviews

Customers who bought this product also purchased
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
F21841
F21841
M438
M438
Z2079
Z2079
DF49
DF49
FGC14249
FGC14249
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies