Top » Catalog » SNPs » FGC45245

$18.00

FGC45245
[FGC45245]

FGC45245
hg38 Position: ChrY:2965100..2965100
Ancestral: T
Derived: C
Reference: Full Genomes (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Below U106 > Z18
Forward Primer: FGC45245_F AGCTCATGCCTGTAATCCTAGTG
Reverse Primer: FGC45245_R AAAAGGGTGGGTCTTGCAG
Reviews

Customers who bought this product also purchased
A10245
A10245
A10244
A10244
PF1237
PF1237
FGC45253
FGC45253
FGC45251
FGC45251
FGC45254
FGC45254
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies