Top » Catalog » SNPs » Y11203

$18.00

Y11203
[Y11203]

Y11203
hg38 Position: ChrY:13815275..13815275
Ancestral: G
Derived: A
Reference: Yfull (2015)
ISOGG Haplogroup: I1a (not listed)
Comments: Below S14887
Forward Primer: Y11203_F GAAAAACTTTCCCTTTACCCTCA
Reverse Primer: Y11203_R TTGTAAATGTAATATAACTTTCCATTTGC
Reviews

Customers who bought this product also purchased
FGC22054
FGC22054
I1-L22 (including P109) Panel
I1-L22 (including P109) Panel
FGC33034
FGC33034
FGC22045
FGC22045
FGC14508
FGC14508
S7660
S7660
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies