Top » Catalog » SNPs » S3539

$18.00

S3539
[S3539]

S3539
hg38 Position: ChrY:12157903..12157903
Ancestral: G
Derived: A
Reference: Jim Wilson
ISOGG Haplogroup: R1b (not listed)
Comments: Aka. CTS2367
Forward Primer: S3539_F AGCTCTTAAGGCAGCGCA
Reverse Primer: S3539_R TTGTAAATACACCAATCAGCGTG
Reviews

Customers who bought this product also purchased
A584
A584
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies