Top » Catalog » SNPs » L226

$18.00

L226
[L226]

L226
hg38 Position: ChrY:16936844..16936844
Ancestral: C
Derived: T
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: R1b1a1a2a1a2c1f2a
Comments: Found in a R-L21* (Irish Type III) WTY participant. Apparently derived in all IT3 samples.
Forward Primer: L226_F TGCCTCCCATAGTGTTAGGG
Reverse Primer: L226_R CAGCCTCCTGGGTTTAAGTG
Reviews

Customers who bought this product also purchased
Z2188
Z2188
Z29749
Z29749
FGC37012
FGC37012
L21
L21
FGC17244
FGC17244
PH2769
PH2769
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies