Top » Catalog » SNPs » L226

$18.00

L226
[L226]

L226
hg38 Position: ChrY:16936844..16936844
Ancestral: C
Derived: T
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: R1b1a1a2a1a2c1a4b2a
Comments: Found in a R-L21* (Irish Type III) WTY participant. Apparently derived in all IT3 samples.
Forward Primer: L226_F TGCCTCCCATAGTGTTAGGG
Reverse Primer: L226_R CAGCCTCCTGGGTTTAAGTG
Reviews

Customers who bought this product also purchased
Z2195
Z2195
BY13693
BY13693
A10499
A10499
FGC41901
FGC41901
Z29749
Z29749
Z2188
Z2188
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies