Top » Catalog » SNPs » Z17780

$18.00

Z17780
[Z17780]

Z17780
hg38 Position: ChrY:9978522..9978522
Ancestral: A
Derived: T
Reference: Y DNA community
ISOGG Haplogroup: G2a2b2a1a1b1a1a1c
Comments: Below Z726 > S2808
Forward Primer: Z17780_F AAGGGGAATATAGGTAAGGCTCC
Reverse Primer: Z17780_R GTGTTGTCTGTGGAAGCCG
Reviews

Customers who bought this product also purchased
Y3101
Y3101
S18765
S18765
Y3098
Y3098
Z726
Z726
Z725
Z725
G2a-L497 Panel
G2a-L497 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies