Top » Catalog » SNPs » Z17780

$18.00

Z17780
[Z17780]

Z17780
hg38 Position: ChrY:9978522..9978522
Ancestral: A
Derived: T
Reference: Y DNA community
ISOGG Haplogroup: G2a2b2a1a1b1a1a1c
Comments: Below Z726 > S2808
Forward Primer: Z17780_F AAGGGGAATATAGGTAAGGCTCC
Reverse Primer: Z17780_R GTGTTGTCTGTGGAAGCCG
Reviews

Customers who bought this product also purchased
Y3101
Y3101
S18765
S18765
Y3098
Y3098
S2784
S2784
Z30739
Z30739
Z726
Z726
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies