Top » Catalog » SNPs » L22

$18.00

L22
[L22]

L22
hg38 Position: ChrY:8707968..8707968
Ancestral: A
Derived: C
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: I1a1b
Comments: aka rs34626372
Forward Primer: L22_F GGTTTGGCTGCAGGACAATGAAATACTGGG
Reverse Primer: L22_R GTCCCATGATCCCAAGGGAAGAC
Reviews

Customers who bought this product also purchased
Y23688
Y23688
Y21091
Y21091
M227
M227
Z58
Z58
Y11264
Y11264
Y6339
Y6339
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies