Top » Catalog » SNPs » L22

$18.00

L22
[L22]

L22
hg38 Position: ChrY:8707968..8707968
Ancestral: A
Derived: C
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: I1a1b
Comments: aka rs34626372
Forward Primer: L22_F GGTTTGGCTGCAGGACAATGAAATACTGGG
Reverse Primer: L22_R GTCCCATGATCCCAAGGGAAGAC
Reviews

Customers who bought this product also purchased
Y16809
Y16809
mtComplete
mtComplete
Y15543
Y15543
FGC29197
FGC29197
Y6341
Y6341
S7642
S7642
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies