Top » Catalog » SNPs » L22

$17.50

L22
[L22]

L22
HG19 Position: ChrY:8576009..8576009
Ancestral: A
Derived: C
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: I1a1b
Comments: aka rs34626372
Forward Primer: L22_F GGTTTGGCTGCAGGACAATGAAATACTGGG
Reverse Primer: L22_R GTCCCATGATCCCAAGGGAAGAC
Reviews

Customers who bought this product also purchased
Z2338
Z2338
S19986
S19986
Z59
Z59
DYS711
DYS711
L849
L849
Y10644
Y10644
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies