Top » Catalog » SNPs » L22

$18.00

L22
[L22]

L22
HG19 Position: ChrY:8576009..8576009
Ancestral: A
Derived: C
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: I1a1b
Comments: aka rs34626372
Forward Primer: L22_F GGTTTGGCTGCAGGACAATGAAATACTGGG
Reverse Primer: L22_R GTCCCATGATCCCAAGGGAAGAC
Reviews

Customers who bought this product also purchased
Z63
Z63
Z2539
Z2539
S244
S244
CTS6364
CTS6364
DF29
DF29
S4795
S4795
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies