Top » Catalog » SNPs » L22

$18.00

L22
[L22]

L22
HG19 Position: ChrY:8576009..8576009
Ancestral: A
Derived: C
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: I1a1b
Comments: aka rs34626372
Forward Primer: L22_F GGTTTGGCTGCAGGACAATGAAATACTGGG
Reverse Primer: L22_R GTCCCATGATCCCAAGGGAAGAC
Reviews

Customers who bought this product also purchased
Z2539
Z2539
S244
S244
CTS6364
CTS6364
DF29
DF29
S4795
S4795
I1-M253 Superclade Panel
I1-M253 Superclade Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies