Top » Catalog » SNPs » L22

$17.50

L22
[L22]

L22
HG19 Position: ChrY:8576009..8576009
Ancestral: A
Derived: C
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: I1a1b
Comments: aka rs34626372
Forward Primer: L22_F GGTTTGGCTGCAGGACAATGAAATACTGGG
Reverse Primer: L22_R GTCCCATGATCCCAAGGGAAGAC
Reviews

Customers who bought this product also purchased
Z2338
Z2338
S19986
S19986
DYS711
DYS711
Z59
Z59
L849
L849
Wish a Panel
Wish a Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies