Top » Catalog » SNPs » L22

$18.00

L22
[L22]

L22
HG19 Position: ChrY:8576009..8576009
Ancestral: A
Derived: C
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: I1a1b
Comments: aka rs34626372
Forward Primer: L22_F GGTTTGGCTGCAGGACAATGAAATACTGGG
Reverse Primer: L22_R GTCCCATGATCCCAAGGGAAGAC
Reviews

Customers who bought this product also purchased
A17732
A17732
A17731
A17731
Y18232
Y18232
Z74
Z74
Y17922
Y17922
L813
L813
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies