Top » Catalog » SNPs » L22

$18.00

L22
[L22]

L22
hg38 Position: ChrY:8707968..8707968
Ancestral: A
Derived: C
Reference: Thomas Krahn (FTDNA)
ISOGG Haplogroup: I1a1b
Comments: aka rs34626372
Forward Primer: L22_F GGTTTGGCTGCAGGACAATGAAATACTGGG
Reverse Primer: L22_R GTCCCATGATCCCAAGGGAAGAC
Reviews

Customers who bought this product also purchased
Y13495
Y13495
Y97485
Y97485
S10778
S10778
S4759
S4759
Y100876
Y100876
Y10646
Y10646
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies