Top » Catalog » SNPs » FGC13899

$18.00

FGC13899
[FGC13899]

FGC13899
hg38 Position: ChrY:2961338..2961338
Ancestral: C
Derived: T
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Below Z251
Forward Primer: FGC13899_F GTTGTTGAAGATGTTGTCATAGAGG
Reverse Primer: FGC13899_R TCACTCGTCAGAGGATCAGTAATG
Reviews

Customers who bought this product also purchased
FGC19534
FGC19534
A2201
A2201
BY3015
BY3015
M168
M168
P312
P312
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies