Top » Catalog » SNPs » FTB34486

$18.00

FTB34486
[FTB34486]

FTB34486
hg38 Position: ChrY:21038003..21038003
Ancestral: G
Derived: A
Reference: FTDNA (2021)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FTB34486_F GTCTGACGAGCAAAGGGAAG
Reverse Primer: FTB34486_R TGCCTACACAGCTGTCCTCA
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies