Top » Catalog » SNPs » ZS8261

$18.00

ZS8261
[ZS8261]

ZS8261
hg38 Position: ChrY:17399302..17399302
Ancestral: G
Derived: A
Reference: Victar Mas (2015)
ISOGG Haplogroup: J1
Comments: Downstream ZS7093 > ZS8260
Forward Primer: ZS8261_F ACTATAAGGCTAATCTTTTCTAAGCTCG
Reverse Primer: ZS8261_R GAAAACTACCCAAAAATATACATGGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies