Top » Catalog » SNPs » Y4882

$18.00

Y4882
[Y4882]

Y4882
hg38 Position: ChrY:18973336..18973336
Ancestral: G
Derived: A
Reference: YFull (2016)
ISOGG Haplogroup: I2a1b2a1a2
Comments: Downstream from S17250
Forward Primer: Y4882_F TGCTCACTGCAAGCTCTGTG
Reverse Primer: Y4882_R CCACAAGAAGTCAACAGAAGACTG
Reviews

Customers who bought this product also purchased
A26390
A26390
Y152112
Y152112
Y141127
Y141127
Y100616
Y100616
MF2888
MF2888
FT14506
FT14506
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies