Top » Catalog » SNPs » FGC16081

$18.00

FGC16081
[FGC16081]

FGC16081
hg38 Position: ChrY:13060123..13060123
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: J2 (not listed)
Comments: Downstream of J-PF5169 (xPF5174)
Forward Primer: FGC16081_F TGAATTTGGGTAGACAGTTCTGC
Reverse Primer: FGC16081_R CCATTTCACATGCAAAGACATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies