Top » Catalog » SNPs » FGC16141

$18.00

FGC16141
[FGC16141]

FGC16141
hg38 Position: ChrY:19588496..19588496
Ancestral: C
Derived: T
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: J2 (not listed)
Comments: Downstream of J-PF5169 (xPF5174)
Forward Primer: FGC16141_F AGACAAGGTCTTTCCCTGTCAC
Reverse Primer: FGC16141_R TTGAGGGAAAACAGGCTGAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies