Top » Catalog » SNPs » BY114

$17.50

BY114
[BY114]

BY114
HG19 Position: ChrY:18053160..18053160
Ancestral: T
Derived: C
Reference: FTDNA
ISOGG Haplogroup: R1b1a2a1a2c1i (not listed)
Comments: Aka FGC14692. Bellow R-DF41
Forward Primer: BY114_F TTTGCAGATACTCTGACTGCTG
Reverse Primer: BY114_R AGGACAGTTGAAGCAAACCAC
Reviews

Customers who bought this product also purchased
FGC5494
FGC5494
DF49
DF49
Z251
Z251
DF13
DF13
Z255
Z255
R1b-L21 Super-Clade Orientation Panel
R1b-L21 Super-Clade Orientation Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies