Top » Catalog » SNPs » BY114

$18.00

BY114
[BY114]

BY114
HG19 Position: ChrY:18053160..18053160
Ancestral: T
Derived: C
Reference: FTDNA
ISOGG Haplogroup: R1b1a2a1a2c1i (not listed)
Comments: Aka FGC14692. Bellow R-DF41
Forward Primer: BY114_F TTTGCAGATACTCTGACTGCTG
Reverse Primer: BY114_R AGGACAGTTGAAGCAAACCAC
Reviews

Customers who bought this product also purchased
L513
L513
A875
A875
Z253
Z253
FGC5494
FGC5494
DF49
DF49
Z251
Z251
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies