Top » Catalog » SNPs » BY114

$18.00

BY114
[BY114]

BY114
HG19 Position: ChrY:18053160..18053160
Ancestral: T
Derived: C
Reference: FTDNA
ISOGG Haplogroup: R1b1a2a1a2c1i (not listed)
Comments: Aka FGC14692. Bellow R-DF41
Forward Primer: BY114_F TTTGCAGATACTCTGACTGCTG
Reverse Primer: BY114_R AGGACAGTTGAAGCAAACCAC
Reviews

Customers who bought this product also purchased
R1b-L21 Superclade Orientation Panel
R1b-L21 Superclade Orientation Panel
FGC11134
FGC11134
L513
L513
A875
A875
Z253
Z253
FGC5494
FGC5494
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies