hg38 Position: ChrY:2781655..2781655
Ancestral: C
Derived: G
Reference: Underhill et al.
ISOGG Haplogroup: B1
Comments: Also observed in several other haplogroups, often co-mutating with M288.
Forward Primer: M236_F GCCTGTAATCCCAGCACTTTG
Reverse Primer: M236_R GAGGCGGAGTCTCGCTC