Top » Catalog » SNPs » S2972

$18.00

S2972
[S2972]

S2972
hg38 Position: ChrY:16690640..16690640
Ancestral: G
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: E1b1b1a1b1a (not listed)
Comments: .
Forward Primer: S2972_F ACTCCTGGCCACAAACAAAC
Reverse Primer: S2972_R CCAACCTCTTTCAGCTCCTG
Reviews

Customers who bought this product also purchased
Y129143
Y129143
Y128213
Y128213
Y128502
Y128502
BY157133
BY157133
V22
V22
FT91330
FT91330
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies