Top » Catalog » SNPs » S2972

$18.00

S2972
[S2972]

S2972
hg38 Position: ChrY:16690640..16690640
Ancestral: G
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: E1b1b1a1b1a (not listed)
Comments: .
Forward Primer: S2972_F ACTCCTGGCCACAAACAAAC
Reverse Primer: S2972_R CCAACCTCTTTCAGCTCCTG
Reviews

Customers who bought this product also purchased
V12
V12
L335
L335
Z834
Z834
BY5355
BY5355
BY5354
BY5354
BY5350
BY5350
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies