Top » Catalog » SNPs » Y3548

$18.00

Y3548
[Y3548]

Y3548
hg38 Position: ChrY:12744908..12744908
Ancestral: A
Derived: G
Reference: YFull (2014)
ISOGG Haplogroup: I2a (not listed)
Comments: Below or equivalent to S17250
Forward Primer: Y3548_F GTTTAAGGCACTCAGATGAAAGAAG
Reverse Primer: Y3548_R GCTTATTCCTGTAAACTAACCAGCC
Reviews

Customers who bought this product also purchased
MF2888
MF2888
Y144303
Y144303
Y99608
Y99608
A16413
A16413
Y14612
Y14612
Y134603
Y134603
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies